Principal Contact
Abstract:
Admixture of Clinical Liquid Waste (CLW) discharging into Ecological Water Bodies (EWB) causes significant pollution with resistant bacteria. The issue is significant in Bangladesh where CLW management is at early stage of development. Extended-Spectrum β-Lactamase (ESBL) pro-ducing bacteria confer resistance to Broad Spectrum β-Lactam Antibiotics (BSBLA) which has be-come a global concern now. The aim of this study was to characterise and assess the occurrence of ESBL producing bacteria in CLW of Bangladesh.Three CLW samples were collected from two leading hospitals inDhaka City, Bangladesh in the year 2012. A total 166 isolates were retrieved and screened for ESBL production by the Double Disk Diffusion Synergy Test (DDST).Isolates with ESBL phenotype were further characterized by antibiotic susceptibility testing, PCR and se-quencing of β-lactamase genes. A total of 30 ESBL producers with Multi Drug Resistant (MDR) properties were isolated. Gene specific PCR against blaTEM, blaCTX-M, and blaSHV detected CTX-M as major ESBL genotype (83%) followed by occurrence of TEM-genotypes (40%). Prevalence of SHV was low in CLW samples (3%). More than 20% of CLW -ESBL isolates possessed both the TEM and CTX-M genotypes. The predominant ESBL isolates were phylogenetically identified as Escherichia spp. Seventy seven percent followed by Citrobacterspp. (17%), Klebsiellaspp. (3%), and Yokenella spp. (3%).This investigation demonstrates that CLW possessesESBL producing MDR bacteria which might act as potential threat to disseminate resistant determinants in the sur-rounding environment.
Key words: ESBL, Multidrug Resistant Bacteria, Clinical Liquid Wastewater, Ecological Water Bodies.
Key words: ESBL, Multidrug Resistant Bacteria, Clinical Liquid Wastewater, Ecological Water Bodies.
Introduction:
Clinical Liquid Waste (CLW) includes hazardous waste materials excreted from inpatient and out-patient departments, laboratories (microbiology, biochemistry, histopathology, blood bank, etc.), operation theatres, radiology and other depart-ments of different hospitals and clinics. The ma-jority of antibiotics used in medicine are only partially metabolized by the patients.1,2 Thus CLW acts as the storehouse of different types of antibiotics and harmful infectious agents such as the pathogens and microorganisms possessing multidrug resistant (MDR) genes. If these ha-zardous CLW remains untreated and discharged directly into the ecological water bodies (EWB); it results in an increase in the active antibiotic concentration and MDR bacteria in EWB and subsequently introduces resistant gene pool to the environment.3 In recent years, the emergence of antibiotic resistant microorganisms (particularly Extended Spectrum β-Lactamase (ESBL) producing and MDR bacteria) in untreated CLW has been evidenced in Bangladesh, where CLW management is at early stage of development.3,5 This may pose a public health risk, which demands the investigation on this issue in a large extent for future evaluation and control.
Antibiotics of β-lactam group have been most widely used in infection management due to its effectiveness on a broad range of microorgan-isms. In Bangladesh, β-lactam antibiotics are one of the most frequently used antibiotic group but unfortunately these drugs are often sold over the counter without a physician’s prescription.6 This indiscriminate and inappropriate use of antibiot-ics results in an alarming situation like the pro-gressive loss of susceptibility towardsβ-lactam antibiotics in the treatment of a wide range of clinical conditions.7 The production of β-lactamases is an important mechanism of resis-tance to β-lactam antibiotics especially in gram negative bacteria.
Extended-Spectrum β-Lactamases (ESBLs) have been contributing to the dramatic increase in resistance to new generation β-lactam agents throughout the world.8-11 Public healthcare units like hospitals and clinics must safeguard the health of the community. But in countries like Bangladesh, healthcare liquid wastes particularly CLW were laden with ESBL-MDR bacteria and seemed to pose a huge public health threat in the transfer of such resistance to the bacterial patho-gens causing community acquired infections, thereby limiting our antibiotic pool. To measure the extent of these threatening microbes in the environment and followed by taking proper initiatives, a detail assessment of ESBL-MDR bacteria is required. Previous studies have shown that Escherichia coli and Klebsiella pneumoniae are the major ESBL-producing organisms worldwide while CTX-M-type enzymes were the most prevalent ESBLs.12-16 There are a few reports from Bang¬ladesh where they found the presence of different ESBL producing gram negative bacteria inCLW.17-20 A report claims thatthe direct relationship between the use of antibiotics and the antibiotic resistance properties of microorganisms.3 In our previous investigation we detected the presence of ESBL within Escherichia spp. from CLW indicating that patients are spreading ESBL-MDR isolates in the environment, through hospital wastes.4 However, still there is a lack of information on molecular characterisation of ESBL producing organisms isolated from CLW in Bangladesh. Therefore, the objectives of the present study were in depth screening and characterization of ESBL producing bacteria from CLW in Bangladesh.
Clinical Liquid Waste (CLW) includes hazardous waste materials excreted from inpatient and out-patient departments, laboratories (microbiology, biochemistry, histopathology, blood bank, etc.), operation theatres, radiology and other depart-ments of different hospitals and clinics. The ma-jority of antibiotics used in medicine are only partially metabolized by the patients.1,2 Thus CLW acts as the storehouse of different types of antibiotics and harmful infectious agents such as the pathogens and microorganisms possessing multidrug resistant (MDR) genes. If these ha-zardous CLW remains untreated and discharged directly into the ecological water bodies (EWB); it results in an increase in the active antibiotic concentration and MDR bacteria in EWB and subsequently introduces resistant gene pool to the environment.3 In recent years, the emergence of antibiotic resistant microorganisms (particularly Extended Spectrum β-Lactamase (ESBL) producing and MDR bacteria) in untreated CLW has been evidenced in Bangladesh, where CLW management is at early stage of development.3,5 This may pose a public health risk, which demands the investigation on this issue in a large extent for future evaluation and control.
Antibiotics of β-lactam group have been most widely used in infection management due to its effectiveness on a broad range of microorgan-isms. In Bangladesh, β-lactam antibiotics are one of the most frequently used antibiotic group but unfortunately these drugs are often sold over the counter without a physician’s prescription.6 This indiscriminate and inappropriate use of antibiot-ics results in an alarming situation like the pro-gressive loss of susceptibility towardsβ-lactam antibiotics in the treatment of a wide range of clinical conditions.7 The production of β-lactamases is an important mechanism of resis-tance to β-lactam antibiotics especially in gram negative bacteria.
Extended-Spectrum β-Lactamases (ESBLs) have been contributing to the dramatic increase in resistance to new generation β-lactam agents throughout the world.8-11 Public healthcare units like hospitals and clinics must safeguard the health of the community. But in countries like Bangladesh, healthcare liquid wastes particularly CLW were laden with ESBL-MDR bacteria and seemed to pose a huge public health threat in the transfer of such resistance to the bacterial patho-gens causing community acquired infections, thereby limiting our antibiotic pool. To measure the extent of these threatening microbes in the environment and followed by taking proper initiatives, a detail assessment of ESBL-MDR bacteria is required. Previous studies have shown that Escherichia coli and Klebsiella pneumoniae are the major ESBL-producing organisms worldwide while CTX-M-type enzymes were the most prevalent ESBLs.12-16 There are a few reports from Bang¬ladesh where they found the presence of different ESBL producing gram negative bacteria inCLW.17-20 A report claims thatthe direct relationship between the use of antibiotics and the antibiotic resistance properties of microorganisms.3 In our previous investigation we detected the presence of ESBL within Escherichia spp. from CLW indicating that patients are spreading ESBL-MDR isolates in the environment, through hospital wastes.4 However, still there is a lack of information on molecular characterisation of ESBL producing organisms isolated from CLW in Bangladesh. Therefore, the objectives of the present study were in depth screening and characterization of ESBL producing bacteria from CLW in Bangladesh.
Materials and Methods:
Study area and sample collection:Three CLW samples were collected from two renowned hos-pitals of Dhaka city: Dhaka Medical College Hospital (DMCH) and Sir Salimullah Medical College Hospital (SSMCH).From DMCH, one sample was collected at the sewage drain of the emergency unit in February, 2012 and another sample was collected from the outdoor sewage drain in April, 2012. In June 2012, one sample was collected from SSMCH CLW-outlet which wasdirectly connected to ecological water body river Buriganga.Each of the CLW samples were collected in a clean sterile 500 ml Schott Duran’s bottle (Schott, Germany). About 200 ml of liquid samples containing suspended particles were collected. Collected samples were directly brought to the laboratory of the Department of Microbiology, University of Dhaka in an insu-lated ice box with minimum delay and were bac-teriologically examined immediately.
Bacterial enumeration and isolation: Collected CLW samples sample was serially diluted up to 10-4 with sterile normal saline (0.85%) and was used for microbiological analysis. Total viable bacterial count was determined for CLW samples using commercially available Nutrient Agar (NA) media (Oxoid, UK). MacConkey (MA) agar (Oxoid, No. 3) was used as a selective cul-ture medium for the detection and isolation of Gram-negative bacteria from CLW samples. Amoxycillin (AM, 50 μg/mL), Ciprofloxacin (CIP, 0.16 μg/mL), and Cephalosporin (CEP, 5 μg/mL) antibiotics were supplemented separately to NA and MA media to determine Total Antibi-otic Resistant Count (TARC), which included-Total Viable Resistant Bacterial Count (TVRBC) and Total Viable Resistant Enterobacteriaceae Count (TVREC), respectively. For total Viable Bacterial Count (TVBC) no antibiotic was used in the NA and MA media. Following incubation at 37°C for18-24 hours, appearance of individual colony on each plate was enumerated and rec-orded in every case. Isolates from DMCH emer-gency unit outflow, outdoor sewage drain, and SSMCH outflow were designated as A, B, C respectively followed by numeric (ex: A1, B1, C1).
Phenotypic detection of ESBL: All of the selected isolates from CLW were tested for ESBL production by phenotypic Double Disk Diffusion Synergy Test (DDST).21 Ceftazidime (CAZ) (30μg), Ceftriaxone (CRO) (30μg), Cefotaxime (CTX), (30μg) and Amoxycillin / Clavulanic acid, (AMC) (30μg) discs were used.
The test inoculum, turbidity matched to 0.5 Optical Density (OD) was spread on Muller-Hinton Agar (MHA) (Oxoid, UK) using a sterile cotton swab. A disc of augmenting (20 µg AM+ 10 µg CLA) was placed on the center of MHA; then discs of CAZ (30μg), CRO (30μg), CTX (30μg), and AZT (30μg) were kept around it in such a way that each disc was at distance ranging between 15 and 20 mm from the augmented disc (Centre to Centre). The plates were incubated at 37°C overnight. The organisms were considered to be ESBL positive when the zone of inhibition around any of the expanded-spectrum Cephalos-porin discs (CAZ/CRO/CTX) showed a clear enhancement towards the augmented disc.
Antibiotic susceptibility tests: The antimicrobial susceptibility pattern of the DDST test positive isolates that were morphologically distinct on NA was determined in vitro by using the stan-dardized agar-disc-diffusion method known as the Kirbey-Bauer.22 It is a modification of Bau-er’s method.23 Sixteen different commercially available antibiotic discs belonging to 11 indi-vidual groups of antibiotics (table II) and MHA were used for the test.
PCR Detection of ESBL Specific Gene and Se-quence Analysis: All the isolates phenotypically positive for ESBL production were selected for detailed molecular analysis. Total DNA from the isolates were prepared as boiled DNA to use as template DNA for PCR. PCRs using primers specific for antibiotic resistance genes such as blaTEM and blaCTX-M were carried out using a thermal cycler (Biometra, Germany). The PCR reactions followed the protocol of Arlet et al. 199524 and Pagani et al 200325 for blaTEM and blaCTX-M respectively. The sequence of the pri-mers used for the PCR reactions were-blaTEMF : ATGAGTATTCAACATTTCCG and bla-TEMR :CCAATGCTTAATCAGTGAGC; bla,CTX-MF :ATGTGCAGYACCAGTAARGT and blaCTX-MR : TGGGTRAARTARGTSACCAGA, with the annealing temperature 55oC and 50oC respectively.Full 1engthsequences(858bp for bla-TEM, and 593 bp for blaCTX-M were assembled into using the SeqMan Genome Assembler (DNAstar, USA) and compared to the GenBank database of the National Center for Biotechnolo-gy Information (NCBI) (http://www.ncbi.nlm.nih.gov/GenBank) by means of the Basic Local Alignment Search Tool (BLAST) to identify close phylogenetic relatives. Multiple sequence alignment of the retrieved reference sequences from NCBI was performed with the ClustalWsoftware26 and was exported to the Molecular Evolutionary Genetics Analysis (MEGA) program27 for phylogenetic tree construction using the Neighbor joining algorithm selecting 1000 boot strap replication.
Plasmid DNA Analysis: Plasmid DNA of ESBL specific gene positive isolates was extracted us-ing Wizard®PlusMinipreps plasmid DNA Purifi-cation kit (Promega, USA). Isolated plasmid DNA was separated in 0.8% agarose gel (ethi-dium bromide added) in a Tris-Acetate-EDTA (TAE) buffer and photograph was taken using GelDoc (AlphaImager, USA). Escherichia coli V517 plasmid was used as control marker plasmid DNA.
16S rRNA Gene Sequencing and Identifica-tion: The 16S rRNA gene of representative ESBL isolates belonging to each morphological group was amplified using primers 27F and 1492R. The purified products were further used for sequencing and phylogenetic analysis as same as the protocol used in case of ESBL genes.
Study area and sample collection:Three CLW samples were collected from two renowned hos-pitals of Dhaka city: Dhaka Medical College Hospital (DMCH) and Sir Salimullah Medical College Hospital (SSMCH).From DMCH, one sample was collected at the sewage drain of the emergency unit in February, 2012 and another sample was collected from the outdoor sewage drain in April, 2012. In June 2012, one sample was collected from SSMCH CLW-outlet which wasdirectly connected to ecological water body river Buriganga.Each of the CLW samples were collected in a clean sterile 500 ml Schott Duran’s bottle (Schott, Germany). About 200 ml of liquid samples containing suspended particles were collected. Collected samples were directly brought to the laboratory of the Department of Microbiology, University of Dhaka in an insu-lated ice box with minimum delay and were bac-teriologically examined immediately.
Bacterial enumeration and isolation: Collected CLW samples sample was serially diluted up to 10-4 with sterile normal saline (0.85%) and was used for microbiological analysis. Total viable bacterial count was determined for CLW samples using commercially available Nutrient Agar (NA) media (Oxoid, UK). MacConkey (MA) agar (Oxoid, No. 3) was used as a selective cul-ture medium for the detection and isolation of Gram-negative bacteria from CLW samples. Amoxycillin (AM, 50 μg/mL), Ciprofloxacin (CIP, 0.16 μg/mL), and Cephalosporin (CEP, 5 μg/mL) antibiotics were supplemented separately to NA and MA media to determine Total Antibi-otic Resistant Count (TARC), which included-Total Viable Resistant Bacterial Count (TVRBC) and Total Viable Resistant Enterobacteriaceae Count (TVREC), respectively. For total Viable Bacterial Count (TVBC) no antibiotic was used in the NA and MA media. Following incubation at 37°C for18-24 hours, appearance of individual colony on each plate was enumerated and rec-orded in every case. Isolates from DMCH emer-gency unit outflow, outdoor sewage drain, and SSMCH outflow were designated as A, B, C respectively followed by numeric (ex: A1, B1, C1).
Phenotypic detection of ESBL: All of the selected isolates from CLW were tested for ESBL production by phenotypic Double Disk Diffusion Synergy Test (DDST).21 Ceftazidime (CAZ) (30μg), Ceftriaxone (CRO) (30μg), Cefotaxime (CTX), (30μg) and Amoxycillin / Clavulanic acid, (AMC) (30μg) discs were used.
The test inoculum, turbidity matched to 0.5 Optical Density (OD) was spread on Muller-Hinton Agar (MHA) (Oxoid, UK) using a sterile cotton swab. A disc of augmenting (20 µg AM+ 10 µg CLA) was placed on the center of MHA; then discs of CAZ (30μg), CRO (30μg), CTX (30μg), and AZT (30μg) were kept around it in such a way that each disc was at distance ranging between 15 and 20 mm from the augmented disc (Centre to Centre). The plates were incubated at 37°C overnight. The organisms were considered to be ESBL positive when the zone of inhibition around any of the expanded-spectrum Cephalos-porin discs (CAZ/CRO/CTX) showed a clear enhancement towards the augmented disc.
Antibiotic susceptibility tests: The antimicrobial susceptibility pattern of the DDST test positive isolates that were morphologically distinct on NA was determined in vitro by using the stan-dardized agar-disc-diffusion method known as the Kirbey-Bauer.22 It is a modification of Bau-er’s method.23 Sixteen different commercially available antibiotic discs belonging to 11 indi-vidual groups of antibiotics (table II) and MHA were used for the test.
PCR Detection of ESBL Specific Gene and Se-quence Analysis: All the isolates phenotypically positive for ESBL production were selected for detailed molecular analysis. Total DNA from the isolates were prepared as boiled DNA to use as template DNA for PCR. PCRs using primers specific for antibiotic resistance genes such as blaTEM and blaCTX-M were carried out using a thermal cycler (Biometra, Germany). The PCR reactions followed the protocol of Arlet et al. 199524 and Pagani et al 200325 for blaTEM and blaCTX-M respectively. The sequence of the pri-mers used for the PCR reactions were-blaTEMF : ATGAGTATTCAACATTTCCG and bla-TEMR :CCAATGCTTAATCAGTGAGC; bla,CTX-MF :ATGTGCAGYACCAGTAARGT and blaCTX-MR : TGGGTRAARTARGTSACCAGA, with the annealing temperature 55oC and 50oC respectively.Full 1engthsequences(858bp for bla-TEM, and 593 bp for blaCTX-M were assembled into using the SeqMan Genome Assembler (DNAstar, USA) and compared to the GenBank database of the National Center for Biotechnolo-gy Information (NCBI) (http://www.ncbi.nlm.nih.gov/GenBank) by means of the Basic Local Alignment Search Tool (BLAST) to identify close phylogenetic relatives. Multiple sequence alignment of the retrieved reference sequences from NCBI was performed with the ClustalWsoftware26 and was exported to the Molecular Evolutionary Genetics Analysis (MEGA) program27 for phylogenetic tree construction using the Neighbor joining algorithm selecting 1000 boot strap replication.
Plasmid DNA Analysis: Plasmid DNA of ESBL specific gene positive isolates was extracted us-ing Wizard®PlusMinipreps plasmid DNA Purifi-cation kit (Promega, USA). Isolated plasmid DNA was separated in 0.8% agarose gel (ethi-dium bromide added) in a Tris-Acetate-EDTA (TAE) buffer and photograph was taken using GelDoc (AlphaImager, USA). Escherichia coli V517 plasmid was used as control marker plasmid DNA.
16S rRNA Gene Sequencing and Identifica-tion: The 16S rRNA gene of representative ESBL isolates belonging to each morphological group was amplified using primers 27F and 1492R. The purified products were further used for sequencing and phylogenetic analysis as same as the protocol used in case of ESBL genes.
Result:
Bacteriological enumeration of clinical liquid wastewater: Total Viable Bacterial Count (TVBC), Total Viable Resistant Bacterial Count (TVRBC), and Total Viable Resistant Enterobac-terial Count (TVREC) were enumerated in CLW collected from DMCH in duplicate (table I). Among TVRBC, total Cirpofloxacin (CIP) resis-tant count was approximately 10 times lower than total Ampicillin (AMP) or Cephalosporin (CEP) resistant viable count (table I).Metcalf et al., 1991 reported that the expected viable bac-terial count in domestic sewage system is 1x10 8cfu/mL.28 Values of Predicted Probable Number (PPN, the ratio of total expected viable count to total viable bacterial count) higher than one (ratio >1) indicated the presence of active antimicrobial agents in the effluents. The find-ings revealed that all CLW samples analyzed during this investigation had a PPN >1, indicat-ing the presence of significant levels of antibio-tics and other toxic compounds in the CLW.
ND indicates Not Detected PPN is the quotient of Total Expected Count to Total Count that was determined using the expected count as 1x 108cfu/mL (Metcalf et al. 1991)
Isolation of ESBL producing bacteria: A total of 166 isolates from NA and MA plates were se-lected and tested for detection of ESBL produc-ers by DDST. Among them, 30 isolates showed three distinguished phenotypic ESBL producing pattern (figure 1).
These 30 ESBL positive isolates were selected for further investigation.
ESBL morphological groups and their antibiotic susceptibility pattern: According to their colony characteristics on MA media, 30 CLW-ESBL isolates were classified into four morphogroups. The four morphogroups were: dark pink and flat; pale pink and gummy; colorless; and dark pink with depression in the middle figure 2.
Plate 1: Group I- dark pink and flat colonies
Plate 2: Group II- pale pink and gummy colonies
Plate 3: Group III- colorless small colonies
Plate 4: Group IV- dark pink colonies
These 30 ESBL positive isolates were selected for further investigation.
ESBL morphological groups and their antibiotic susceptibility pattern: According to their colony characteristics on MA media, 30 CLW-ESBL isolates were classified into four morphogroups. The four morphogroups were: dark pink and flat; pale pink and gummy; colorless; and dark pink with depression in the middle figure 2.
Their antibiogram were analyzed against 11 dif-ferent groups of antibiotics. Isolates showed maximum resistance against β-lactam group of antibiotics (Cefotaxime-CTX), followed by Penicillin group (Ampicillin-AMP and Amoxycillin-AM) whereas, most of the isolates were susceptible to Imipenem-IMP and Levofloxacin-LEV.
Four morphological groups of CLW-ESBLs were distinctly different in their antibiotic resistance pattern. Group I has 23 isolates, among which 20 isolates were resistant to CTX and 16 isolates were resistant to AMP. Group II had one isolate A20, which was resistant to AMP, TET, CIP, FEP, and CTX. Group III had one isolate A16, which showed resistance against AMP and CTX, and sensitive to all other antibiotics tested. Group IV has five isolates and all of them were resistant to AMP, CTX, and CAZ.
Amoxycillin (AM), Ampicillin (AMP), Amikacin (AK), Azithromycin (AZM), Aztreonam (AZT), Cirpofloxacin (CIP), Levofloxacin (LEV), Chloramphenicle (C), Cefepime (FEP), Cefotaxime (CTX), Ceftazidime (CAZ), Ceftriaxone (CRO), Cefixime (CFM), Imipenem (IMP), Nitrofuran (N), Tetracycline (TET)
Analysis of extended spectrum β-Lactamase (ESBL) Genes:The prevalent ESBL genotype was blaCTX-M type, 83% of among the total iso-lates (table II, figure 3). The frequency of bla-TEM genotype was 40% (12/30) and only 3% (1/30) were positive for blaSHV gene (table II). On the other hand, 23% of the isolates had both blaTEM and blaCTX-M genes.
Sequencing and homology search using Gen Bank database of the ESBL specific blaTEM and blaCTX-M genes showed that all TEM positive isolates were 100% similar to TEM-1 enzyme of Escherichia coli strain AS713010 (JN037848.1). All CTX positive isolates showed 100% similari-ty with Escherichia coli strain BLSE2012CF1 CTX-M-15 (figure2).
The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 1.48188406 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. Evolutionary analyses were conducted in MEGA5.
Accession number of NCBI submitted ESBL-TEM positive isolates are KJ544233-40 and ESBL- CTX positive isolates are KJ544208-26.
Plasmid Profile of ESBL Isolates: Among 30 ESBL positive MDR isolates seven isolates were plasmid free. They included: B4, B24, C32, C79, C84, and C100 (morphogroup I) and A20 (morphogroup III). Large plasmids above the chromosomal range were found in sevenisolates. Among them, isolate A18 contains only a large size plasmid, whereas, others contain three or more small size plasmids at varying size ranges.
The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 1.48188406 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. Evolutionary analyses were conducted in MEGA5.
16S rRNA gene identification of ESBL positive CLW: 16S rRNA gene sequences of isolates A12, B2, B4, B57, and C6 from the dominant mor-phogroup, Group I of CLW-ESBL (figure 4, table II) clustered with Escherichia spp. specifically with Escherichia fergusonii except isolate B2 which was more closely related to Escherichia coli (figure 5). Isolate A20 of group II, A16 of group III and A3 of group IV were closely related to Klebsiellasp, Yokenella sp. and Citrobacter sp., respectively (figure 3). Accession number of NCBI submitted 16s rRNA gene sequences of CLW-ESBL isolates are KJ544191-98.
In Bangladesh, all CLW originated from hospit-als, veterinaries, and other sources directly or via municipality drainage system are discharged into ecological water bodies resulting serious pollu-tions of environment with resistant bacteria and resistant gene pool pollutions. In the ecological water bodies, bacteria from different sources like CLW, agriculture, urban and industrial wastewa-ter are mixed together and genetic exchange be-tween the environmental species and allochthon-ous species may occur resulting new pathogenic bacteria of clinical importance.29 Recently, the presence of antimicrobial-resistant bacteria in different ecological niches in Bangladesh has been reported.29 Therefore, this problem has been assessed in current study, and the samples con-sisted of pathogenic and antibiotic resistant bac-teria (table I). In this study, bacterial concentra-tion in the CLW was found to be lower than 108 cfu/100 mL (table I), indicating the presence of antimicrobial agents in CLW.28 Our recent quantitative analysis of antibiotics concentrations in CLW clearly demonstrated that CLW con-tained different antibiotics at MIC50 or sub-MIC50 levels (unpublished). Furthermore, these resistant bacteria contained transferable resistant markers. As a result, there remains a potential risk of resistant bacteria and resistant gene pool pollution of the environment.4 Theadmixing of CLW with ecological water bodies like river, ponds, cannel, lakes etc. may cause serious pollutions and become a subject of clinical importance because this pollution cycles through food-chain and water.30
In the present study, three different ESBL phenotypes for each of 30 ESBL positive isolates were observed and some additional isolates susceptible to CAZ, CRO, CTX and AMC (A22, B4, B24 and B57) were confirmed as ESBLs through genotypic screening. ESBLs are typically recognized for their unusual antibiotic resistance to their hosts, but there are also reports suggesting intermediate or even susceptible phenotype.31 Among the 61 ESBL isolates, 61% isolates were Escherichia spp. and 11% were Klebsiella spp. CLW samples predominantly contained Escherichia spp. (figure 4). Among 30 CLW-ESBLs, 77% Escherichia spp. And 3% Klebsiellaspp. were found. Yokenella spp. (3%) and Citrobacterspp. (17%)were less prevalent and have barely been reported as ESBL producers. Although Yo-kenella spp. has been reported from the environ-ment, their presence in clinical settings is very recent32 and therefore underestimated as a clini-cally significant pathogen or even ESBLs. The present study is so far the first report of Yokenel-la spp. from Bangladesh as ESBL producer.
The dominant genotype of ESBL among the three ESBL coding genes (blaTEM, blaCTX-Msub>, and blaSHV), were detected to be CTX-M type fol-lowed by TEM genotype. Among the 61 ESBL isolates, 83%, 40%, and 13% of CLW isolates were blaCTX-M, blaTEM, and blaSHV types, respec-tively (Table II). Simultaneous presence of bla-TEM and blaCTX-M genes was detected in 27% of CLW isolates. Phylogenetically, it was observed that TEM1 and CTX-M-15 types were predomi-nant in Bangladesh samples (figure 4).In India, CTX-M-15 genotype was reported to be domi-nant within E. coli (75%) and Klebsiellaspp. (73%).33 Simultaneous presence of blaCTX-M and blaTEM was reported from hospital waste water and clinical samples in Brazil.34 The dominance or co-dominance of CTX-M gene within the iso-lates may be due to overuse of ceftriaxone or due to fecal carriage and transfer gene by horizontal transmission.33-35
ESBLs are reported as mutant enzymes originat-ing from TEM or SHV enzymes and can be plasmid mediated.36 Bacteria can resist β-lactam antibiotics with the help of hydrolyzing enzymes, β-lactamases, which can be chromosome mediated, too.37-39 In the current study, many of the ESBL isolates harbored multiple plasmids, indicating that the multidrug resistance properties of the isolates might be plasmid borne. Seven of the phenotypically and genotypically confirmed ESBL isolates from CLW did not harbor plasmid under the experimental conditions but they had a multidrug resistance profile (table II). This indi-cated the possibility of chromosomal inheritance of ESBL enzyme and other antibiotic resistance genes. ESBL producing strains contain MDR plasmids that may easily be transmitted between members of Enterobacteriaceae, consequently ESBL producing organisms are resistant to a variety of classes of antibiotics. As a result of horizontal gene transfer (HGT) by mobile genetic elements such as plasmids, transposons, and by transduction, non-ESBL producing pathogens might become potent ESBL producing pathogens, which is of significant concern because this event may evolve new and clinically important pathogenic bacteria.29
Conclusion: The present investigation analyzes a comparative perspective of phenotypic and genotypic ESBL producing bacteria from CLW in Bangladesh. The dominant ESBL producers in CLW samples from Bangladesh were detected to be Escherichia spp. and the dominant genotype was of CTX-M-15 type. The ESBL properties as well as multidrug resistance phenomena can be either chromosome or plasmid mediated. The epidemiology of ESBL-producing bacteria is a growing concern in Bangladesh with increasingly blurred boundaries between hospitals and the community.So, there is an urgent need to monitor and control the spreadof ESBLs in the environment.
Acknowledgements: Authors gratefully ac-knowledge the supportof University Grants Commission (UGC) and Ministry of Science and Technology (MOST), for conduction of the study. Authors also thankful to TWAS for equipment grant.
Orcid ID: 0000-0003-2855-0453
Academic Discipline: Microbiology
Type: Experimental (Microbiological)
Bacteriological enumeration of clinical liquid wastewater: Total Viable Bacterial Count (TVBC), Total Viable Resistant Bacterial Count (TVRBC), and Total Viable Resistant Enterobac-terial Count (TVREC) were enumerated in CLW collected from DMCH in duplicate (table I). Among TVRBC, total Cirpofloxacin (CIP) resis-tant count was approximately 10 times lower than total Ampicillin (AMP) or Cephalosporin (CEP) resistant viable count (table I).Metcalf et al., 1991 reported that the expected viable bac-terial count in domestic sewage system is 1x10 8cfu/mL.28 Values of Predicted Probable Number (PPN, the ratio of total expected viable count to total viable bacterial count) higher than one (ratio >1) indicated the presence of active antimicrobial agents in the effluents. The find-ings revealed that all CLW samples analyzed during this investigation had a PPN >1, indicat-ing the presence of significant levels of antibio-tics and other toxic compounds in the CLW.
Table I: Total and resistant bacteria count in Clinical Liquid Waste (CLW).
Bacterial count |
Count (cfu/mL) (an average of duplicate plate count) |
||||||
Sample 1 |
Sample 2 |
Sample 3 |
|||||
1. Total Viable Bacterial Count (TVBC) |
4.475x104 |
2.05x106 |
2.05x105 |
||||
2. Total Enterobacteriaceae Count (TEC) |
3.90x104 |
4.45x105 |
6.5 x104 |
||||
3. Total Antibiotic Resistant Count (TARC) |
|||||||
A. Total Viable Resistant Bacterial Count (TVRBC) |
|||||||
i) Total Ampicillin Resistant Viable Bacterial Count (TARVB) |
ND |
3.15 x105 |
1.70 x105 |
||||
ii) Total Ciprofloxacin Resistant Viable Bacterial Count (TCRVB) |
ND |
5.5 x104 |
5.0 x104 |
||||
iii) Total Cephalosporin Resistant Viable Bacterial Count (TCERVB) |
ND |
3.0x105 |
6.0x104 |
||||
B. Total Viable Resistant Enterobacterial Count (TVREC) |
|||||||
Total Ampicillin Resistant Enterobacterial Count (TAREC) |
ND |
1.50 x104 |
6.5 x103 |
||||
Predicted Probable Number (PPN) |
>1 |
>1 |
>1 |
||||
ND indicates Not Detected PPN is the quotient of Total Expected Count to Total Count that was determined using the expected count as 1x 108cfu/mL (Metcalf et al. 1991)
Isolation of ESBL producing bacteria: A total of 166 isolates from NA and MA plates were se-lected and tested for detection of ESBL produc-ers by DDST. Among them, 30 isolates showed three distinguished phenotypic ESBL producing pattern (figure 1).
These 30 ESBL positive isolates were selected for further investigation.
ESBL morphological groups and their antibiotic susceptibility pattern: According to their colony characteristics on MA media, 30 CLW-ESBL isolates were classified into four morphogroups. The four morphogroups were: dark pink and flat; pale pink and gummy; colorless; and dark pink with depression in the middle figure 2.
Plate 1: Group I- dark pink and flat colonies
Plate 2: Group II- pale pink and gummy colonies
Plate 3: Group III- colorless small colonies
Plate 4: Group IV- dark pink colonies
These 30 ESBL positive isolates were selected for further investigation.
ESBL morphological groups and their antibiotic susceptibility pattern: According to their colony characteristics on MA media, 30 CLW-ESBL isolates were classified into four morphogroups. The four morphogroups were: dark pink and flat; pale pink and gummy; colorless; and dark pink with depression in the middle figure 2.
Their antibiogram were analyzed against 11 dif-ferent groups of antibiotics. Isolates showed maximum resistance against β-lactam group of antibiotics (Cefotaxime-CTX), followed by Penicillin group (Ampicillin-AMP and Amoxycillin-AM) whereas, most of the isolates were susceptible to Imipenem-IMP and Levofloxacin-LEV.
Four morphological groups of CLW-ESBLs were distinctly different in their antibiotic resistance pattern. Group I has 23 isolates, among which 20 isolates were resistant to CTX and 16 isolates were resistant to AMP. Group II had one isolate A20, which was resistant to AMP, TET, CIP, FEP, and CTX. Group III had one isolate A16, which showed resistance against AMP and CTX, and sensitive to all other antibiotics tested. Group IV has five isolates and all of them were resistant to AMP, CTX, and CAZ.
Table II: Four morphogroups of ESBL isolates showing variations in their drug resistance pattern and genotyping of β-lactamases genes.
Source |
Isolate ID |
Antibiotic Resistance Pattern |
blatem |
blactx-M |
blashv |
Gr. I; Dark pink and flat
|
A12 |
AMP, TET, N, CIP, AZM, AZT, FEP, CTX, CAZ |
+ |
+ |
- |
A18 |
AMP, TET, ATM, FEP, CTX, CAZ |
- |
+ |
- |
|
A19 |
AMP, N, CTX |
- |
+ |
- |
|
A22 |
AMP, N, AZM, FEP, CTX |
- |
+ |
- |
|
B2 |
IMP, AZT, FEP, CTX, CAZ |
- |
+ |
- |
|
B4 |
AMP |
+ |
- |
- |
|
B7 |
AMP, TET, CIP, AZM, IMP, AZT, FEP, CTX, CAZ |
- |
+ |
- |
|
B15 |
AZT, CTX, CAZ |
- |
+ |
- |
|
B18 |
AZT, CTX, CAZ |
- |
+ |
- |
|
B24 |
AMP, AZT, CRO |
+ |
- |
- |
|
B29 |
AZT, FEP, CAZ |
- |
+ |
- |
|
B57 |
CTX, CAZ |
+ |
+ |
- |
|
C6 |
AMP, TET, N, CIP, AZM, AK, AZT, C, FEP, CTX, CAZ |
+ |
+ |
- |
|
C13 |
AMP, N, AZT, FEP, CTX, CAZ, CRO |
+ |
- |
- |
|
C32 |
AMP, AZT, FEP, CTX, CAZ, CRO |
- |
+ |
- |
|
C39 |
AMP, TET, AZM, AZT, FEP, CTX, CAZ, CRO |
- |
+ |
- |
|
C47 |
IMP, FEP, CTX |
+ |
+ |
- |
|
C49 |
AMP, TET, N, CIP, AZM, CTX |
+ |
+ |
- |
|
C57 |
ATM, FEP, CTX, CAZ |
- |
+ |
- |
|
C72 |
AMP, CIP, AZM, ATM, CTX, CAZ |
+ |
- |
- |
|
C79 |
AMP, CIP, CTX |
- |
+ |
- |
|
C84 |
AMP, CIP, AZM, ATM, FEP, CTX |
- |
+ |
- |
|
C100 |
AMP, CTX |
+ |
+ |
- |
|
Gr. II:Pale pink and gummy |
A20 |
AMP, TET, CIP, FEP, CTX |
+ |
+ |
- |
Gr. III:Colorless |
A16 |
AMP, CTX |
- |
- |
- |
Gr. IV:Dark pink with a depression in the middle |
A3 |
AMP, TET, N, CIP, AK, IMP, AZT, FEP, CTX, CAZ |
+ |
+ |
- |
C18 |
AMP, AZT, FEP, CTX, CAZ |
- |
+ |
+ |
|
C67 |
AMP, TET, CIP, AZM, AZT, FEP, CTX, CAZ, CRO |
- |
+ |
- |
|
C70 |
AMP, TET, AK, AZT, FEP, CTX, CAZ, CRO |
- |
+ |
- |
|
C92 |
AMP, CTX, CAZ |
- |
+ |
- |
Analysis of extended spectrum β-Lactamase (ESBL) Genes:The prevalent ESBL genotype was blaCTX-M type, 83% of among the total iso-lates (table II, figure 3). The frequency of bla-TEM genotype was 40% (12/30) and only 3% (1/30) were positive for blaSHV gene (table II). On the other hand, 23% of the isolates had both blaTEM and blaCTX-M genes.
Sequencing and homology search using Gen Bank database of the ESBL specific blaTEM and blaCTX-M genes showed that all TEM positive isolates were 100% similar to TEM-1 enzyme of Escherichia coli strain AS713010 (JN037848.1). All CTX positive isolates showed 100% similari-ty with Escherichia coli strain BLSE2012CF1 CTX-M-15 (figure2).
The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 1.48188406 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. Evolutionary analyses were conducted in MEGA5.
Accession number of NCBI submitted ESBL-TEM positive isolates are KJ544233-40 and ESBL- CTX positive isolates are KJ544208-26.
Plasmid Profile of ESBL Isolates: Among 30 ESBL positive MDR isolates seven isolates were plasmid free. They included: B4, B24, C32, C79, C84, and C100 (morphogroup I) and A20 (morphogroup III). Large plasmids above the chromosomal range were found in sevenisolates. Among them, isolate A18 contains only a large size plasmid, whereas, others contain three or more small size plasmids at varying size ranges.
The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 1.48188406 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. Evolutionary analyses were conducted in MEGA5.
16S rRNA gene identification of ESBL positive CLW: 16S rRNA gene sequences of isolates A12, B2, B4, B57, and C6 from the dominant mor-phogroup, Group I of CLW-ESBL (figure 4, table II) clustered with Escherichia spp. specifically with Escherichia fergusonii except isolate B2 which was more closely related to Escherichia coli (figure 5). Isolate A20 of group II, A16 of group III and A3 of group IV were closely related to Klebsiellasp, Yokenella sp. and Citrobacter sp., respectively (figure 3). Accession number of NCBI submitted 16s rRNA gene sequences of CLW-ESBL isolates are KJ544191-98.
Table III: Number and size of plasmids from ESBL isolates of CLW samples
Isolate ID |
Group |
Number of plasmid |
Plasmid size (Kb) |
Large Plasmid |
|||||||||
A12 |
1 |
3 |
4.2 |
1.4 |
|
|
|
|
|
|
|
+ |
|
A18 |
1 |
|
|
|
|
|
|
|
|
|
+ |
||
A19 |
ND |
||||||||||||
A22 |
3 |
5.3 |
4.8 |
2.6 |
|
|
|
|
|
|
|
||
B2 |
3 |
5.3 |
3.5 |
<1 |
|
|
|
|
|
|
|
||
B4 |
No plasmid |
||||||||||||
B7 |
4 |
5.5 |
3.8 |
2.6 |
1.2 |
|
|
|
|
|
|
||
B15 |
4 |
6.1 |
5.5 |
4.6 |
|
|
|
|
|
|
+ |
||
B18 |
4 |
6.1 |
5.5 |
4.6 |
|
|
|
|
|
|
+ |
||
B24 |
No plasmid |
||||||||||||
B29 |
1 |
6.3 |
|
|
|
|
|
|
|
|
|
||
B57 |
3 |
5.5 |
3.3 |
|
|
|
|
|
|
|
+ |
||
C6 |
5 |
6.1 |
5.3 |
4.4 |
3.5 |
<1 |
|
|
|
|
|
||
C13 |
3 |
5.7 |
4.6 |
|
|
|
|
|
|
|
+ |
||
C32 |
No plasmid |
||||||||||||
C39 |
1 |
1.7 |
|
|
|
|
|
|
|
|
|
||
C47 |
6 |
6.6 |
6.4 |
4.5 |
3.2 |
1.3 |
<1 |
|
|
|
|
||
C49 |
3 |
1.7 |
<1 |
<1 |
|
|
|
|
|
|
|
||
C57 |
1 |
5.1 |
|
|
|
|
|
|
|
|
|
||
C72 |
4 |
8.1 |
6.3 |
3.8 |
2.9 |
|
|
|
|
|
|
||
C79 |
No plasmid |
||||||||||||
C84 |
No plasmid |
||||||||||||
C100 |
No plasmid |
||||||||||||
A20 |
2 No plasmid |
|
|
|
|||||||||
A16 |
3 |
2 5.8 2.0 |
|||||||||||
A3 |
4 |
5 |
4.6 |
4.0 |
3.1 |
1.7 |
|
|
|
|
|
+ |
|
C18 |
1 |
4.7 |
|
|
|
|
|
|
|
|
|
||
C67 |
1 |
1.1 |
|
|
|
|
|
|
|
|
|
||
C70 |
1 |
<1 |
|
|
|
|
|
|
|
|
|
||
C92 |
|
2 |
6.0 |
4.6 |
|
|
|
|
|
|
|
|
|
Discussion
In Bangladesh, mostly CLW is directly released into municipal sewage system and subsequently discharged into the ecological water bodies. CLW contains resistant pathogenic bacteria and non-metabolized antimicrobial agents. To under-stand the contribution of CLW in the pollution of ecological water bodies, this investigation demonstrated that i) Predicted Probable Number (PPN) microbial populations in CLW was lower than the expected value; ii) CLW contained MDR and ESBL producing bacteria with CTX-M and TEM specific dominant genotypes; iii) the predominant species were Escherichia spp., Klebsiella spp. and Citrobacterspp. ; and iv) An-tibiotic resistance properties might be both plasmid mediated and chromosomal borne.In Bangladesh, all CLW originated from hospit-als, veterinaries, and other sources directly or via municipality drainage system are discharged into ecological water bodies resulting serious pollu-tions of environment with resistant bacteria and resistant gene pool pollutions. In the ecological water bodies, bacteria from different sources like CLW, agriculture, urban and industrial wastewa-ter are mixed together and genetic exchange be-tween the environmental species and allochthon-ous species may occur resulting new pathogenic bacteria of clinical importance.29 Recently, the presence of antimicrobial-resistant bacteria in different ecological niches in Bangladesh has been reported.29 Therefore, this problem has been assessed in current study, and the samples con-sisted of pathogenic and antibiotic resistant bac-teria (table I). In this study, bacterial concentra-tion in the CLW was found to be lower than 108 cfu/100 mL (table I), indicating the presence of antimicrobial agents in CLW.28 Our recent quantitative analysis of antibiotics concentrations in CLW clearly demonstrated that CLW con-tained different antibiotics at MIC50 or sub-MIC50 levels (unpublished). Furthermore, these resistant bacteria contained transferable resistant markers. As a result, there remains a potential risk of resistant bacteria and resistant gene pool pollution of the environment.4 Theadmixing of CLW with ecological water bodies like river, ponds, cannel, lakes etc. may cause serious pollutions and become a subject of clinical importance because this pollution cycles through food-chain and water.30
In the present study, three different ESBL phenotypes for each of 30 ESBL positive isolates were observed and some additional isolates susceptible to CAZ, CRO, CTX and AMC (A22, B4, B24 and B57) were confirmed as ESBLs through genotypic screening. ESBLs are typically recognized for their unusual antibiotic resistance to their hosts, but there are also reports suggesting intermediate or even susceptible phenotype.31 Among the 61 ESBL isolates, 61% isolates were Escherichia spp. and 11% were Klebsiella spp. CLW samples predominantly contained Escherichia spp. (figure 4). Among 30 CLW-ESBLs, 77% Escherichia spp. And 3% Klebsiellaspp. were found. Yokenella spp. (3%) and Citrobacterspp. (17%)were less prevalent and have barely been reported as ESBL producers. Although Yo-kenella spp. has been reported from the environ-ment, their presence in clinical settings is very recent32 and therefore underestimated as a clini-cally significant pathogen or even ESBLs. The present study is so far the first report of Yokenel-la spp. from Bangladesh as ESBL producer.
The dominant genotype of ESBL among the three ESBL coding genes (blaTEM, blaCTX-Msub>, and blaSHV), were detected to be CTX-M type fol-lowed by TEM genotype. Among the 61 ESBL isolates, 83%, 40%, and 13% of CLW isolates were blaCTX-M, blaTEM, and blaSHV types, respec-tively (Table II). Simultaneous presence of bla-TEM and blaCTX-M genes was detected in 27% of CLW isolates. Phylogenetically, it was observed that TEM1 and CTX-M-15 types were predomi-nant in Bangladesh samples (figure 4).In India, CTX-M-15 genotype was reported to be domi-nant within E. coli (75%) and Klebsiellaspp. (73%).33 Simultaneous presence of blaCTX-M and blaTEM was reported from hospital waste water and clinical samples in Brazil.34 The dominance or co-dominance of CTX-M gene within the iso-lates may be due to overuse of ceftriaxone or due to fecal carriage and transfer gene by horizontal transmission.33-35
ESBLs are reported as mutant enzymes originat-ing from TEM or SHV enzymes and can be plasmid mediated.36 Bacteria can resist β-lactam antibiotics with the help of hydrolyzing enzymes, β-lactamases, which can be chromosome mediated, too.37-39 In the current study, many of the ESBL isolates harbored multiple plasmids, indicating that the multidrug resistance properties of the isolates might be plasmid borne. Seven of the phenotypically and genotypically confirmed ESBL isolates from CLW did not harbor plasmid under the experimental conditions but they had a multidrug resistance profile (table II). This indi-cated the possibility of chromosomal inheritance of ESBL enzyme and other antibiotic resistance genes. ESBL producing strains contain MDR plasmids that may easily be transmitted between members of Enterobacteriaceae, consequently ESBL producing organisms are resistant to a variety of classes of antibiotics. As a result of horizontal gene transfer (HGT) by mobile genetic elements such as plasmids, transposons, and by transduction, non-ESBL producing pathogens might become potent ESBL producing pathogens, which is of significant concern because this event may evolve new and clinically important pathogenic bacteria.29
Conclusion: The present investigation analyzes a comparative perspective of phenotypic and genotypic ESBL producing bacteria from CLW in Bangladesh. The dominant ESBL producers in CLW samples from Bangladesh were detected to be Escherichia spp. and the dominant genotype was of CTX-M-15 type. The ESBL properties as well as multidrug resistance phenomena can be either chromosome or plasmid mediated. The epidemiology of ESBL-producing bacteria is a growing concern in Bangladesh with increasingly blurred boundaries between hospitals and the community.So, there is an urgent need to monitor and control the spreadof ESBLs in the environment.
Acknowledgements: Authors gratefully ac-knowledge the supportof University Grants Commission (UGC) and Ministry of Science and Technology (MOST), for conduction of the study. Authors also thankful to TWAS for equipment grant.
References
- Golet EM, Xifra I, Siegrist H, Alder AC, Giger W. Environmental exposure assessment of fluoroquino-lone antibacterial agents from sewage to soil. Envi-ronmental science & technology. 2003;37(15):3243-49.
- Martinez JL. Environmental pollution by antibiotics and by antibiotic resistance determinants. Environ-mental pollution. 2009;157(11):2893-902.
- Islam M, Uddin M, Hakim M, Das K, Hasan M. Role of untreated liquid hospital waste to the devel-opment of antibiotic resistant bacteria. J Innov Dev Strategy. 2008;2(2):17-21.
- Adnan N, Sultana M, Islam OK, Nandi SP, Hossain MA. Characterization of Ciprofloxacin resistant Ex-tended Spectrum [Beta]-Lactamase (ESBL) produc-ing Escherichia spp. from clinical waste water in Bangladesh. Advances in Bioscience and Biotech-nology. 2013;4(7B):15
- Akter F, Amin MR, Osman KT, Anwar MN, Karim MM, Hossain MA. Ciprofloxacin-resistant Escheri-chia coli in hospital wastewater of Bangladesh and prediction of its mechanism of resistance. World Journal of Microbiology and Biotechnology. 2012;28(3):827-34.
- Rahman MM, Haq JA, Hossain MA, Sultana R, Islam F, Islam AH. Prevalence of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in an urban hospital in Dhaka, Bangladesh. International journal of antimicrobial agents.2004; 24 (5):508-10. doi:10.1016/j.ijantimicag.2004.05.007
- Okeke IN, Lamikanra A, Edelman R. Socioeconomic and behavioral factors leading to acquired bacterial resistance to antibiotics in developing countries. Emerging infectious diseases. 1999;5(1):18.
- Bradford PA. Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clinical microbiology reviews. 2001;14(4):933-51.
- Bush K. New beta-lactamases in gram-negative bacteria: diversity and impact on the selection of an-timicrobial therapy. Clin Infect Dis.2001; 32 (7):1085-89.
- Perez F, Endimiani A, Hujer KM, Bonomo RA. The continuing challenge of ESBLs. Current opinion in pharmacology. 2007;7(5):459-69.
- Paterson DL. Resistance in gram-negative bacteria: Enterobacteriaceae. The American Journal of Medi-cine. 2006;119(6):S20-S28.
- Hernández J, Martinez-Martinez L, Cantón R, Coque T, Pascual A, Infections SGfN. Nationwide study of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum β-lactamases in Spain. Antimicrobial agents and chemotherapy. 2005;49(5):2122-25.
- Mugnaioli C, Luzzaro F, De Luca F, Brigante G, Perilli M, Amicosante G, et al. CTX-M-type ex-tended-spectrum β-lactamases in Italy: molecular epidemiology of an emerging countrywide problem. Antimicrobial agents and chemotherapy. 2006;50(8):2700-06.
- Radice M, Power P, Di Conza J, Gutkind G. Early dissemination of CTX-M-derived enzymes in South America. Antimicrobial agents and chemotherapy. 2002;46(2):602-04.
- Ryoo NH, Kim E-C, Hong SG, Park YJ, Lee K, Bae IK, et al. Dissemination of SHV-12 and CTX-M-type extended-spectrum β-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae and emergence of GES-3 in Korea. Journal of Antimicrobial Chemotherapy. 2005;56(4):698-702.
- Rawat D, Nair D. Extended-spectrum ß-lactamases in gram negative bacteria. Journal of global infectious diseases. 2010;2(3):263.
- Ashfaq KMA, Pijush S, Majharul IM, Kant OR, Chandra BG. Screening of antibiotic resistant gram negative bacteria and plasmid profiling of multi-drug resistant isolates present in sewage associated with health care centers. International Journal of Medical Research & Health Sciences. 2013;2(4):923-30.
- Lina TT, Khajanchi BK, Azmi IJ, Islam MA, Mah-mood B, Akter M, et al. Phenotypic and Molecular Characterization of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Bangladesh. PloS one. 2014;9(10):e108735.
- Mowla R, Imam KA-H, Asaduzzaman M, Nasrin N, Raihan SZ, Chowdhury AA. Emergence of multidrug resistant extended-spectrum β-lactamase producing Eshcherichia coli associated with urinary tract infections in Bangladesh. Journal of basic and clinical pharmacy. 2011;3(1):225.
- Yesmin T, Hossain M, Paul S, Mahmud C, Kabir M, Haque N, et al. Prevalence and antimicrobial suscep-tibility pattern of ESBL producing isolates. Mymen-singh medical journal: MMJ. 2013;22(4):625-31.
- Jarlier V, Nicolas M-H, Fournier G, Philippon A. Extended broad-spectrum β-lactamases conferring transferable resistance to newer β-lactam agents in Enterobacteriaceae: hospital prevalence and suscep-tibility patterns. Review of Infectious Diseases. 1988;10(4):867-78.
- Barry AL, Thornsberry C. Susceptibility tests: Dif-fusion test procedures. In: Lennette EH, Balows A, Hausler Jr WJ, Shadomy HJ, eds. . Manual of Clini-cal Microbiology. 1985; 978-87
- Bauer A, Kirby W, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology. 1966;45(4):493.
- Arlet G, Brami G, Decre D, Flippo A, Gaillot O, Lagrange P, et al. Molecular characterisation by PCR-restriction fragment length polymorphism of TEM β-lactamases. FEMS Microbiology Letters. 1995;134(2-3):203-08.
- Pagani L, Dell'Amico E, Migliavacca R, D'Andrea MM, Giacobone E, Amicosante G, et al. Multiple CTX-M-type extended-spectrum β-lactamases in nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. Journal of clinical micro-biology. 2003;41(9):4264-69.
- Larkin MA, Blackshields G, Brown N, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947-48.
- Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolu-tion. 2007;24(8):1596-99.
- Metcalf E. Wastewater engineering treatment, dis-posal and reuse McGraw-Hill book co. Singapore; 1991.
- Lupo A, Coyne S, Berendonk TU. Origin and evolu-tion of antibiotic resistance: the common mechanisms of emergence and spread in water bodies. Analyzing possible intersections in the resistome among human, animal and environment matrices. 2012:116
- Rashid M, Rakib MM, Hasan B. Antimicrobial-resistant and ESBL-producing Escherichia coli in different ecological niches in Bangladesh. Infection Ecology & Epidemiology. 2015;5.
- Philippon A, Labia R, Jacoby G. Extended-spectrum beta-lactamases. Antimicrobial Agents and Chemo-therapy. 1989;33(8):1131.
- Lo Y-C, Chuang Y-W, Lin Y-H. Yokenellaregens-burgei in an immunocompromised host: a case report and review of the literature. Infection. 2011;39(5):485-88.
- Ensor V, Shahid M, Evans J, Hawkey P. Occur-rence, prevalence and genetic environment of CTX-M β-lactamases in Enterobacteriaceae from Indian hospitals. Journal of Antimicrobial Chemotherapy. 2006;58(6):1260-63.
- Cavaco L, Abatih E, Aarestrup FM, Guardabassi L. Selection and persistence of CTX-M-producing Escherichia coli in the intestinal flora of pigs treated with amoxicillin, ceftiofur, or cefquinome. Antimi-crobial agents and chemotherapy. 2008;52(10):3612-16.
- Pitout JD, Laupland KB. Extended-spectrum β-lactamase-producing Enterobacteriaceae: an emerging public-health concern. The Lancet infectious Diseases. 2008;8(3):159-66.
- Sirot D. Extended-spectrum plasmid-mediated β-lactamases. Journal of Antimicrobial Chemotherapy. 1995;36(suppl A):19-34.
- Bonnet R. Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrobial Agents and Chemotherapy. 2004;48(1):1-14.
- Bush K, Jacoby GA. Updated functional classifica-tion of β-lactamases. Antimicrobial Agents and Chemotherapy. 2010;54(3):969-76.
- Pitout JD, Laupland KB, Church DL, Menard ML, Johnson JR. Virulence factors of Escherichia coli isolates that produce CTX-M-type extended-spectrum β-lactamases. Antimicrobial agents and Chemotherapy. 2005;49(11):4667-70.
Academic Discipline: Microbiology
Type: Experimental (Microbiological)