Bangladesh Medical Research Council Bulletin
Home / Archives / Vol 47 No 1 (2021) / Research Articles
Antimicrobial Effect of Syzygium cumini Extract Against Methicillin Non-Susceptible Staphylococcus aureus
Syeda Tasneem Towhid
Department of Microbiology, Jagannath University, Dhaka, Bangladesh.
Mahbub-Ul Alam
Department of Microbiology, Jagannath University, Dhaka, Bangladesh.
Muhammad Asaduzzaman
Department of Microbiology, Stamford University, Dhaka, Bangladesh
Md. Shahjalal Sagor
Food and Feed Safety Laboratory, Bangladesh Livestock Research Institute, Savar, Bangladesh.
Mohammad Asheak Mahmud
Food and Feed Safety Laboratory, Bangladesh Livestock Research Institute, Savar, Bangladesh.
Mohammed Abdus Samad
Bangladesh Livestock Research Institute, Savar, Bangladesh.
Keywords: Methicillin, Methicillin-resistant Staph. aureus, Syzygium extract, Non-susceptible to methicillin.
DOI: 10.3329/bmrcb.v47i1.55802
Abstract
Background: Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of infections in Community- Associated (CA) as well as Hospital-Associated (HA) settings. Identification of new antibacterial agents from natural sources takes the forefront in research.
Objectives: The aim of the present study was to identify the resistance pattern of S. aureus in the clinical samples causing disease in Dhaka city, molecular typing of the methicillin non-susceptible S. aureus isolates and identifying new herbal components with anti-microbial effect against S. aureus.
Methods: We screened total of 78 clinical specimen of various nature (pus, urine, tracheal aspirate, conjunctiva and wound swab) with confirm S. aureus infection between March 2018 to October 2018. The specimen were cultured on mannitol salt agar to isolate S. aurues, which were later tested for antibiotic resistance according to disc diffusion method. The MRSA isolates were confirmed with PCR and typed for SCCmec element to know the distribution of hospital-associated and community-associated strains. Finally, the MRSA isolates were cultured in the presence of leaf extract and fruit extract of Syzygium cumini for observing the antibacterial potential.
Result: A total of 12 isolates of S. aureus were found to be non-susceptible to methicillin, 34%, 25%, 17% out of these were from pus, blood and urine respectively and 8% isolates were from wound swab, conjunctiva and tracheal aspirates each. Out of methicillin non-susceptible isolates, 25% and 16% were HA-MRSA and CA- MRSA respectively, as seen from PCR analysis of the SCCmec gene cassette of the S. aureus genome. The rest of the 59% of the isolates were untypable. Overall, higher concentration of leaf and fruit extract reduced the optical density of MRSA culture and reduced bacterial growth in drop plate significantly.
Conclusion: Dhaka population has S. aureus with varying sensitivity against methicillin, which needs further characterization by molecular epidemiology methods.
Keywords: Methicillin, Methicillin-resistant Staph. aureus, Syzygium extract, Non-susceptible to methicillin.
Introduction
Methicillin is a â-lactam antibiotic, chemically related to semi-synthetic penicillin.1 It was called Staphcillin due to effect against pathogenic staphylococci resistant to penicillin.2 The resistance against penicillin in Staphylococcus aureus (S. aureus) came from the enzyme penicillinase.3 Methicillin-resistant S. aureus (MRSA) are a class of genetically similar strains of
S. aureus that are resistant to methicillin, and are a leading cause of skin and soft-tissue infections in hospital patients as well as in healthy persons.4 MRSA strains differ from methicillin-sensitive S. aureus (MSSA) strains with insertion of a mobile genetic element, SCCmec into on the chromosome gene or fX.5 MRSA produces mutant Penicillin binding protein 2a (PBP2a’) (encoded by mecA gene) upon exposure to a β-lactam antibiotics.6 MRSA also produces â- lactamase enzymes (encoded by extracellular enzyme blaZ) decreases â-lactam antibiotic activity.7 Staphylococcus is the major pathogen in family Staphylococcaceae that accounts for the majority of the abscesses, large boils and wound infections.8 S. aureus cause many other human infections of skin, soft tissue, respiratory tissue and bone joints, causing endovascular infections like bacteremia, endocarditis, sepsis, and toxic shock syndrome, thus termed one of the major human pathogens.9 In the previous decade, the MRSA strains have expanded worldwide and currently became a concern for nosocomial diseases.10 The annual death frequency from MRSA is raising quickly surpassing human immunodeficiency virus/ acquired immune deficiency syndrome.11 Bangladesh is a densely populated developing country and many people suffer from unawareness, illiteracy, indiscriminate use of antibiotics and malnutrition.12 Inadequate number of toilets and lack of anal hygiene, life style, poor economic status, lack of safe disposal of excreta also play a role in the spread of bacterial infection. MRSA was found to be the second most abundant critical drug-resistant pathogen in Bangladesh.13 The high rate of nasal carriage of MRSA in apparently healthy adults and association with bovids and poultry creates a high bioburden of MRSA in our population.14 A specific lineage of MRSA is in circulation in Bangladesh (ST772), that originated in India in 2004.15
The emergence of pathogenic microorganisms with drug resistance is a cause of global concern because they threaten to bring back the death tolls of pre-antibiotic era. The long and resource-intensive process of making new antibiotics calls for search in alternate directions. Systematic study is necessary to identify natural compounds that can inhibit Methicillin-resistant S. aureus (MRSA) or Methicillin-intermediate
S. aureus (MISA) isolates in vivo. The rationale behind the study was to employ bioinformatics to identify natural molecules with binding capacity to the resistance factors in MRSA in vitro, so that we have alternate to expensive synthetic antibiotics in the time of rise of the super-bugs. The aim of the present study was to identify the resistance pattern of S. aureus in the clinical samples causing disease in Dhaka city, molecular typing of the methicillin non-susceptible S. aureus isolates and identifying new herbal components with anti-microbial effect against S. aureus. We hypothesized about antimicrobial activity of herbal compound Syzygium cumini (Family: Myrtaceae) against MRSA/MISA. After initial characterization of targeted bacteria with molecular methods, the organism was subjected to confirmation of Hospital- associated MRSA (HA-MRSA) and Community- associated MRSA (CA-MRSA) by conventional molecular technique (PCR). We determined minimum inhibitory concentration of the natural molecule by broth dilution method, allowing antibacterial activity of Syzygium cumini fruit and leaf extracts against clinical MRSA and MISA isolates. Such studies are important to keep track of genotypes of emerging pathogens so that effective containment strategies could be implemented to save lives both in and out of healthcare settings.
Materials and Methods
Bioinformatics Analysis: Mutant â-lactamase (bla) and mutant penicillin binding protein (PBP-2a’) are responsible for resistance against methicillin in S. aureus. 16 We retrieved the 3D structure of these 2 proteins from Protein Databank (https://www.rcsb.org/structure/3ZFZ, https://www.rcsb.org/structure/1mwu), subjected each of them to ligand-binding search using ZINC 15 database (https://zinc.docking.org/), which turned up a number natural molecule that bind to different domains of the target proteins (figure 1).
Collection of Samples: The samples were collected between the periods of March to October, 2018, from Dr. Sirajul Islam Medical College, Asgar Ali Hospital, Rusmono General Hospital, Popular Diagnostic Center located in Dhaka city, Bangladesh. Initial processing of sample and transportation was maintained as per WHO guideline (Official Website, 2010).17
Phenotypic Screening, antibiotic sensitivity test and selection of MRSA: Molecular (PCR) confirmed isolates (nuc gene positive S. aureus) were subjected to Kirby-Bauer disk diffusion assay for determination of antibiotic sensitivity according to Clinical and Laboratory Standards Institute (CLSI) standards M02- A12 and M07-A10.18,19 Isolates demonstrated resistance or intermediate-resistance to Methicillin antibiotic was defined as methicillin resistant S. aureus (MRSA) or methicillin intermediate-resistanceS. aureus (MISA) respectively (table I).
SCCmec typing of MRSA isolates: Around 3× 108 CFU/ml of bacterial suspension was used for DNA extraction following the protocol from Qiagen, Germany. Polymerase Chain Reaction (PCR) was done according to the established protocol as described in Ghaznavi-Rad et al, 2010 with a slight modification.19 A volume of 25µlPCR-mix was prepared using 10 pmol of corresponding forward and reverse primers, 200ng of template DNA, nuclease free water and TaqMan® universal PCR Mastermix (Thermo- Fisher Scientific, USA). Initial denaturation of 95°C for 15 minutes, then 30 cycles with denaturation of 94°C for 30 s, annealing at 57°C for 1.5 minutes, elongation at 72°C for 1.5 minutes and a final elongation step of 72°C for 10 minutes in a Mx3005P platform (Strategene, USA). The PCR products were resolved in a 0.7% agarose gel (Merck, Germany) (Figure 2) with 100bp Invitrogen DNA ladder (Thermo Fisher Scientific, USA). List of primer and amplified target DNA sized used in this study are provided in (table III).
Preparation of S. cumini Leaf and Fruit Extract: Disinfected leaf and fruit samples were stored at - 4°C, homogenized without water and filtered through 0.22µm Whatmann filter using gravitational flow, concentrated with a vacuum membrane distillation system at 120 psi (AVMD Inc. Denmark).
Minimum Inhibitory Concentration (MIC) and drop plate assay: The isolate suspensions were adjusted to 0.5 McFarland, further diluted to 107 CFU/ml. The final reaction mix contained 5%, 2.5% and 1.25% extracts of S. cumini leaf or fruit. The test tubes were incubated for further 24 h, and observed visually for any change in color indicating bacterial growth. The lowest concentration at which the isolate is completely inhibited (as evidenced by the absence of visible bacterial growth) was recorded as MIC value. The efficacy of the extracts was assayed with drop-plate technique and subsequent colony count. From every test tube used in MIC test, 50 µl broth was inoculated into MSA agar for drop plate assay. After 18-24 hours of incubation, micro-colonies appearing on test drops were enumerated with magnifying glass. The numbers of colonies appearing on the controls and the test reactions were analyzed statistically (figure 3).
Statistics and data Analysis: Zone of inhibition data from the Kirby-Bauer disk diffusion test compiled using spreadsheet (MS Excel, Microsoft Corporation, USA) and used as input file in BacLink software to format the data for further analysis using WHONET-2019 software (WHO Collaborating Centre for Surveillance of Antimicrobial Resistance, USA).20 In the drop plate assay, One-way ANOVA was done between number of colonies from both controls and those from test samples in SPSS (v21). The study was approved by the Department of Microbiology, Jagannath University, Dhaka and the research work was done in Bangladesh Livestock Research Institute, Savar.
Results
In community and hospital environment, one of the most common causes of serious infection is Staphylococcus aureus. This study had been designed to identify natural compound from Syzygium cumini that can inhibit MRSA and MISA isolates in vitro. In bioinformatic analysis; the simplified docking analysis of 3-dimentional structures of â-lactamase and PBP-2a’ molecules from MRSA strains retrieved from protein data bank (www.rcsb.org) were used to identify ligands from natural molecule database ZiNC15 (www.zinc.docking.org). The mutant Penicillin Binding Protein 2a’ (PBP-2a’) responsible for penicillin- resistance binds to molecules belonging to azolidine, harzol and phenanthrene groups (Figure 1). The â- lactamase binds to molecules belonging to pyrrolidine, phenolic compounds, phenanthrene group and L- arabinose (data not shown). S. aureus (MRSA) and it’s binding partners among natural molecule. There is potential ligand-epitope interaction predicted between mutant PBP-2a’ and small molecule inhibitor interaction.
All the natural molecules shown to bind to PBP-2a’ and â-lactamase are found in Indian Blackberry plant (S. cumini), as reported by HPLC analysis by other groups. Therefore, we proceeded to study the effect of the fruit extract and leaf extract on Methicillin non- susceptible clinical isolates of S. aureus from Bangladesh.
In phenotypic antimicrobial sensitivity test, among the 12 isolates, all tested resistant against amoxicillin, most were resistant linezolid 91.7% (n=11; 95%CI: 60-99%) and cefoxitin 75% (n=09; 95% CI: 43.4-93) (table I). Sensitivity to vancomycin was higher (40%).
Antibiotics | Code | Break Points | MISA (n=5) | MRSA (n=7) | Overall (n=12) | |||
---|---|---|---|---|---|---|---|---|
% R | 95% C.I. | % R | 95% C.I. | % R | 95% C.I. | |||
Cefoxitin | FOX | S >= 22 | 80 | 30-99 | 71.4 | 30-95 | 75 | 43-93 |
Linezolid | LNZ | S >= 21 | 100 | 46-100 | 85.7 | 42-99 | 91.7 | 60-99 |
Trimethoprim/ Sulfamethoxazole |
SXT | 11 – 15 | 80 | 30-99 | 57.1 | 20-88 | 66.7 | 35-89 |
Vancomycin | VAN | 15 – 16 | 40 | 7.0-83 | 42.9 | 12-80 | 41.7 | 16-71 |
Azithromycin | AZM | 14 – 17 | 60 | 17-93 | 57.1 | 20-88 | 58.3 | 29-83 |
Amoxicillin | AMX | S >= 29 | 100 | 46-100 | 100 | 56-100 | 100 | 70-100 |
Overall 83.3% (n=10/12) isolates (including 5/5; 100% MISA and 5/7; 71.4% MRSA isolates) were termed as MDR isolate according to the widely used standardized international terminology and WHONET 2019 analysis.21 Among the all isolates, 75% and 41.6% isolates were classified as possible-XDR (extreme drug resistant) and possible-PDR (pan-drug resistant) isolate (Table II) according to the alert level definition for S. aureus provided by the expert panel of European Centre for Disease Prevention and Control (ECDC) and Centers for Disease Control and Prevention (CDC).
Isolate | Source | Resistance profile | Number of classes non-susceptible | Resistance level according to WHONET & CDC alert | ||
---|---|---|---|---|---|---|
MDR Profile | XDR Profile | PDR Profile | ||||
S12 | Blood | MET* FOX§ AMXθ | 2 | MDRΩ | ||
S04 | Pus | MET LNZφ SXTî AZM© AMX | 4 | |||
S09 | Wound Swab | MET LNZ SXT AZM AMX | 4 | |||
S10 | Pus | MET FOX LNZ SXT AMX | 4 | MDR | Possible XDRω | |
S11 | Urine | MET FOX LNZ SXT AMX | 4 | MDR | Possible XDR | |
S01 | Blood | MET LNZ SXT VAN¡ AZM AMX | 5 | MDR | Possible XDR | |
S05 | Urine | MET FOX LNZ SXT AZM AMX | 5 | MDR | Possible XDR | |
S02 | Pus | MET FOX LNZ SXT VAN AZM AMX | 6 | MDR | Possible XDR | Possible PDRî |
S03 | Pus | MET FOX LNZ SXT VAN AZM AMX | 6 | MDR | Possible XDR | Possible PDR |
S06 | Blood | MET FOX LNZ SXT VAN AZM AMX | 6 | MDR | Possible XDR | Possible PDR |
S07 | Tracheal | MET FOX LNZ SXT VAN AZM AMX | 6 | MDR | Possible XDR | Possible PDR |
S08 | Conjunctiva | MET FOX LNZ SXT VAN AZM AMX | 6 | MDR | Possible XDR | Possible PDR |
MRSA and MISA isolates were examined with different primers Type I, Type II, Type III, Type IVa, Type IVb, Type IVc, Type IVd, Type IVh and Type V. Analysis of SCCmec gene cassette using multiplex-PCR technique revealed 25% HA-MRSA (hospital associated) and 25% CA-MRSA (community associated) was confirmed based on the result of Type I-613bp, Type III-243bp and Type IVa-776bp, Type IVh-663bp respectively. Whereas 50% isolates was unidentified (Figure 2).
The assessment of minimum inhibitory concentration relies on the ability of leaf and fruit extracts concentration to inhibit drug resistant clinical strains. Under the treatment conditions used here, when the organism was treated with by at least 1.25% v/v fruit or leaf extract compared to positive control, inhibited growth proliferation. A concentration of 2.5% maintained growth at control level compared to 1.25%, while 5.0% inhibited growth proliferation following 24 h exposure (Figure 3).
Purpose | Primer | Primer (5’-3’) | Product Size (bp) | Tm Value(°C) |
---|---|---|---|---|
Identification | nu-F3 | TCGCTTGCTATGATTGTGG | 359 | 52 |
nu-nucR | GCCAATGTTCTACCATAGC | |||
Methicillin resistant gene | mecA-1F | GTAGAAATGACTGAACGTCCGATAA | 310 | 50 |
mecA-2F | CCAATTCCACATTGTTTCGGTCTAA | |||
SCCmec Typing (mPlex PCR) | TypeI_f | GCTTTAAAGAGTGTCGTTACAGG | 613 | 57 |
TypeI_r | GTTCTCTCATAGTATGACGTCC | |||
TypeII_f | GATTACTTCAGAACCAGGTCAT | 287 | ||
TypeII_r | TAAACTGTGTCACACGATCCAT | |||
TypeIII_f | CATTTGTGAAACACAGTACG | 243 | ||
TypeIII_r | GTTATTGAGACTCCTAAAGC | |||
TypeIVa_f | GCCTTATTCGAAGAAACCG | 776 | ||
TypeIVa_r | CTACTCTTCTGAAAAGCGTCG | |||
TypeIVb_f | AGTACATTTTATCTTTGCGTA | 1000 | ||
TypeIVb_r | AGTCATCTTCAATATGGAGAAAGTA | |||
TypeIVc_f | TCTATTCAATCGTTCTCGTATT | 677 | ||
TypeIVc_r | TCGTTGTCATTTAATTCTGAACT | |||
TypeIVd_f | AATTCACCCGTACCTGAGAA | 1242 | ||
TypeIVd_r | AGAATGTGGTTATAAGATAGCTA | |||
TypeIVh_f | TTCCTCGTTTTTTCTGAACG | 663 | ||
TypeIVh_r | CAAACACTGATATTGTGTCG | |||
TypeV_f | GAACATTGTTACTTAAATGAGCG | 325 | ||
TypeV_r | TGAAAGTTGTACCCTTGACACC |
Discussion
S. aureus occupies the list of multi-disease pathogens because of myriads of virulence factors.22 Methicillin-resistant S. aureus was reported in 1990 by Matthews.23 The pathogens become more dangerous with acquisition of multi-drug resistance genes.16 Methicillin non-susceptible S.aureus was declared a highly critical pathogen in 2016 by the World Health Organization due to the high cases of fatality associated with bloodstream infections, pneumonia and post-surgical infections, dialysis recipients and long-term inmates of the intensive care units.24 As of 2005, 20% of all clinical isolates of S. aureus were resistant to methicillin.25 In USA, 90% of all hospital- associated infections by methicillin non-susceptible S. aureus (MnsSA) occurred to patients in post- operative units with a 50% rate of mortality.26
The transmission, management, prevalence, morbidity and mortality of community-associated methicillin- resistant S. aureus (CA-MRSA), hospital-associated methicillin-resistant S. aureus (HA-MRSA) and, a third category reported very recently, livestock-associated MRSA (LA-MRSA) are very different.27 Proper identification of the category of clinical MRSA is important for effective infection control. HA-MRSA is spread by infected patients, contaminated fomites and clinical personnel whereas CA-MRSA is transmitted by poor hygiene and drug-overuse.28 The occurrence of 5-10% MRSA in the community and 1% MRSA in a healthcare facility defines an endemic situation requiring implementation of specialized disinfection protocol.29 All these emphasis on the clinical categorization of MRSA prompted us to analyze the 12 clinical isolates of methicillin non-susceptible S. aureus with PCR typing (Figure 2). The short time period of sample collection and occurrence of too few MRSA is insufficient for any conclusive information for public health informatics. However, the non- susceptibility of methicillin-intermediate isolates indicate an increase in evolution of resistance against methicillin. Distribution of MnsSA isolates across all age/sex groups and all anatomical sites indicate redundancy of the infection. Our findings are consistent with the other reports from Bangladesh by Parvez et al. and Ahmed et al.30,31 Yet, the PCR typing of SCCmec gene cluster for clinical categorization does not match ours, because the other groups could determine all their clinical isolates with the common primers for HA-MRSA and CA-MRSA typing (table III) and no report emerges on untypable SCCmec cluster from Bangladesh.32,33 We rationalize that livestock- associated MRSA might have spread widely in the Dhaka population in the recent years (2017-18), showing up in our study, which probably was negligible before.
The high labour, effort and cost in developing new generations of antibiotics pressed scientists to look for affordable and sustainable options such as identification of antimicrobial molecules from natural sources. S. cumini is an interesting target for potential anti-microbial activity because it is traditionally known to heal infections.34 There are scores of published articles from Asia showing inhibitory effect of S. cumini on S. aurues. Ethanolic extract of S cumini leaves was shown to disrupt quorum sensing and biofilm development of S. aurues.35 Holoacetic acid extract of S. cumini leaves has an MIC value of 70µg/ml on S. aureus.36 Methanolic extact of S. cumini leaves had an MBC of 1.56-50 mg/ml on S. aureus.37 Ethanolic fraction of S. cumini leaf and seed extract inhibited drug-sensitive and drug-resistant isolates of S. aurues.38 Methanolic extract of S. cumini leaves and fruit was shown to be more effective against S. aurues than aqueous extracts.27 Our study adds some more experimental data on the effect of S. cumini on MnsSA: aqueous extracts of both fruits and leaf extract from S. cumini have inhibitory effect on multi-drug resistant clinical isolates of S. aurues at an MIC of 1.25-5% v/v (figure 3). A preliminary bioinformatic analysis shows that the major active ingredients in S. cumini leaf and fruits extracts have potential molecular targets on S. aureus (figure 1). Though rudimentary, these experimental data show great future prospect of S. cumini as an antibacterial molecule.
Conclusion
Findings of this study could serve as very strong background data for advanced studies, such as conformational dynamics of the bioactive ingredients of S. cumini on ligand-binding sites on S. aurues. Such studies have been done on other natural molecules and their chemical modifications have been done to construct a substrate-delivered antibacterial agent that has increased bioavailability against S. aureus. The half-maximal inhibitory concentration
(IC50) of S. cumini leaf, seed and fruit extract needs to be determined. Pathologic profile of the clinical isolates should be done using LukS/F-PV virulence determinants. Finally, a thorough PCR typing of the SCCmec gene cassette should be done using HA-, CA- and LA- specific primers of S. aureus to identify all available clinical isolates properly, in case an infection control protocol needs to be established. The variants of mec A gene also need to be typed to understand the evolving resistance of methicillin- intermediate clinical strains of S. aurues.
Acknowledgments
The authors are indebted to the Laboratory of Food and Feed Safety, Bangladesh Livestock Research Institute, Savar.
References
Submission
2020-07-16
Accepted
2021-03-30
Published
2021-04-01
Apply citation style format of Bangladesh Medical Research Council
Issue
Vol 47 No 1 (2021)
Section
Research Articles
Ethical Clearance
Department of Microbiology, Jagannath University, Dhaka, Bangladesh on February 2018.
Financial Support
This project was done from internal funding of the authors from both Jagannath University and Bangladesh Livestock Research Institute.
Conflict of Interest
Authors declare no conflict of interest.
|| An open access, peer-revewed (single-blind) journal of the Bangladesh Medical Research Council ||
ISSN: 2224-7238 (Online) || ISSN: 0377-9238 (Print)